single-guide rna plasmid ligated into bbsi-digested phu6-grna  (Addgene inc)

Journal: ACS Nano

Article Title: Bone Marrow-Targeted Liposomes Loaded with Bortezomib Overcome Multiple Myeloma Resistance

doi: 10.1021/acsnano.4c10597

Figure Lengend Snippet: ATBL uptake is CXCR4 dependent. (A) CXCR4 expression in the indicated MM cell lines was evaluated using flow cytometry ( n = 3/cell line). (B) A schematic illustration of the transwell migration assay in which MM cell migration in response to SDF-1 chemokine is assessed in the presence of AMD-L. (C) CAG cells were treated with AMD-L (1.62 ± 0.35 × 10 12 liposomes/ml), AMD-F (25 μM), EMPTY-L (1.52 ± 0.96 × 10 12 liposomes/ml) or control for 90 min. Migration of the treated cells was assessed by the transwell assay at the 24 h time point ( n = 5/group). (D) In vitro cellular uptake of Cy5 labeled AMD-L (4.86 ± 1.04 × 10 11 liposomes/ml) versus EMPTY-L (4.56 ± 1.19 × 10 11 liposomes/ml) was assessed in RPMI, CAG and U266 MM cell lines by flow cytometry ( n = 3/group). (E) A schematic illustration of the 4-step procedure to evaluate MM cell apoptosis in the presence of different treatments. (F) The late apoptosis profile of RPMI cells treated for 48 h with the indicated types of liposomes was assessed by flow cytometry ( n = 3/group). (G) Viability of RPMI MM cells was assessed in the presence of increasing concentrations of BTZ-F and ATBL. IC50 measurements per treatment are indicated ( n = 3/group). (H–I) CXCR4 expression on RPMI cells knocked down for CXCR4 (RPMI-KD) and their wild-type counterpart (RPMI-WT*) was assessed by flow cytometry. A representative histogram is shown in H, and mean fluorescence intensity (MFI) is shown in I ( n = 3–4/group). (J) In vitro cellular uptake of rhodamine labeled AMD-L (4.86 ± 1.04 × 10 11 liposomes/ml) compared to EMPTY-L (4.56 ± 1.19 × 10 11 liposomes/ml) was assessed in MM RPMI-KD and RPMI-WT* cells by flow cytometry ( n = 3/group). Results are presented as mean ± SD. One-way ANOVA was used for the statistical analysis in A, C and F with multiple comparisons test. Two-way ANOVA was used for the statistical analysis in D and J with multiple comparisons test. Two-tailed unpaired Student’s t test was used for the statistical analysis in I, adjusted p-value; ** p < 0.01, *** p < 0.001, **** p < 0.0001. ns; not significant; MM, multiple myeloma; RPMI, RPMI8226; RPMI-KD, RPMI8226 CXCR4 knockdown cells; RPMI-WT*, RPMI8226 wild type cells that underwent the same genetic manipulation as the RPMI-KD cells, but without the inclusion of the guide RNA; IC50, half maximal inhibitory concentration; ATBL, AMD targeted bortezomib liposomes; BTZ-F, bortezomib free drug; BTZ-L, bortezomib liposomes; AMD-F, AMD3100 free drug; AMD-L, AMD3100 liposomes; EMPTY-L, empty nontargeted liposome; Control, vehicle.

Article Snippet: A single guide RNA (gRNA) for CXCR4 (forward: 5′CACCG AGGGGACTATGACTCCATGA 3′; reverse: 5′AAAC TCATGGAGTCATAGTCCCCT C 3′) was cloned into the lentiCRISPR v2 vector plasmid (Addgene, Watertown, MA, USA Cat# 52961) containing puromycin resistance using the Golden Gate assembly reaction as described.

Techniques: Expressing, Flow Cytometry, Transwell Migration Assay, Migration, Liposomes, Control, Transwell Assay, In Vitro, Labeling, Fluorescence, Two Tailed Test, Knockdown, Concentration Assay

Journal: ACS Nano

Article Title: Bone Marrow-Targeted Liposomes Loaded with Bortezomib Overcome Multiple Myeloma Resistance

doi: 10.1021/acsnano.4c10597

Figure Lengend Snippet: In vivo therapeutic effect of ATBL in MM bearing mice. (A) A schematic illustration of the experimental design for evaluating ATBL therapeutic effect in vivo : Eight-week-old SCID mice were systemically irradiated (250 rad). After 24 h, MM RPMI cells (5 × 10 6 /mouse) were intravenously injected. On day 21, when sufficient tumor burden was detected by IVIS, mice were intravenously administered with ATBL (1.95 ± 0.43 × 10 13 liposomes/kg), BTZ-L (1.93 ± 0.43 × 10 13 liposomes/kg) or control, once a week for a 5-week period. (B–C) Tumor growth and expansion was assessed using the IVIS imaging system on the indicated days ( n = 5–7 mice/group). (D) At end point, mice were sacrificed, and bone paraffin sections were immunostained with CD138+ (brown) or H&E (Scale bar, 200 μm). (E) In a parallel experiment, SCID mice were treated with ATBL, BTZ-F or control at the same concentrations described in (A) starting on day 28 for 5 weeks. Survival was monitored ( n = 4–6 mice/group). (F) A schematic illustration of the experimental design: Eight-week-old SCID mice were systemically irradiated (250 rad). After 24 h, RPMI-KD or RPMI-WT* MM cells were intravenously injected (5 × 10 6 /mouse). When sufficient tumor burden was detected by IVIS (day 21 and for RPMI-WT*; day 28 for RPMI-KD), ATBL (1.95 ± 0.43 × 10 13 liposomes/kg) or control was intravenously administrated once a week for 4 weeks. (G) Representative IVIS images of RPMI-KD and RPMI-WT* tumor bearing mice at 21 and 14 days, respectively, post MM cell inoculation. (H) Tumor growth in mice described in F was assessed using the IVIS imaging system on the indicated days ( n = 5–6 mice/group). (I) Bar graph indicating tumor size at end point (day 91). Shown are the Kaplan–Meier survival curve, median survival, and p-values using the Wilcoxon statistical test. Results in C and H are presented as mean ± SE. Two-way ANOVA was used for the statistical analysis in C and H with multiple comparisons test. Results in I are presented as mean ± SD. Two-tailed unpaired Student’s t test was used for the statistical analysis in I, adjusted p-value; ** p < 0.01, *** p < 0.001, **** p < 0.0001. ns, not significant; MM, multiple myeloma; RPMI, RPMI8226; RPMI-KD, RPMI8226 CXCR4 knockdown cells; RPMI-WT*, RPMI8226 wild type cells that underwent the same genetic manipulation as the RPMI-KD cells, but without the inclusion of the guide RNA; ATBL, AMD targeted bortezomib liposomes; BTZ-F, bortezomib free drug; BTZ-L, bortezomib liposomes; Control, vehicle.

Article Snippet: A single guide RNA (gRNA) for CXCR4 (forward: 5′CACCG AGGGGACTATGACTCCATGA 3′; reverse: 5′AAAC TCATGGAGTCATAGTCCCCT C 3′) was cloned into the lentiCRISPR v2 vector plasmid (Addgene, Watertown, MA, USA Cat# 52961) containing puromycin resistance using the Golden Gate assembly reaction as described.

Techniques: In Vivo, Irradiation, Injection, Liposomes, Control, Imaging, Two Tailed Test, Knockdown

Journal: ACS Nano

Article Title: Bone Marrow-Targeted Liposomes Loaded with Bortezomib Overcome Multiple Myeloma Resistance

doi: 10.1021/acsnano.4c10597

Figure Lengend Snippet: ATBL biodistribution and toxicity. (A) A schematic illustration of the biodistribution experimental design, as detailed in Materials and Methods. Eight-week old SCID mice were systemically irradiated at a dose of 250 rad. After 24 h, MM RPMI cells (5 × 10 6 /mouse) were intravenously injected. On day 21, when sufficient tumor burden was detected by IVIS, rhodamine-labeled ATBL (1.95 ± 0.43 × 10 13 liposomes/kg), AMD-L (8.10 ± 1.74 × 10 13 liposomes/kg) or EMPTY-L (7.59 ± 1.98 × 10 13 liposomes/kg) were intravenously administrated. After 24 h, mice were sacrificed, and bone-marrow (BM) cells were flushed from the bones and analyzed by flow cytometry ( n = 5 mice/group). (B) The percentage of rhodamine positive cells in the BM is presented. (C) The percentage of rhodamine positive MM cells expressing CXCR4 in the BM is presented. (D) A schematic illustration of dose limiting toxicity experimental design, as detailed in Materials and Methods. (E) The percent in body weight change of mice treated with control or increasing doses of ATBL over a 7-day period. ATBL doses corresponded to equivalent doses of BTZ 0.5, 1, 2, and 5 mg/kg, calculated based on liposome concentrations of 9.77 ± 2.16 × 10 12 , 1.95 ± 0.43 × 10 13 , 3.91 ± 0.86 × 10 13 , 9.77 ± 2.16 × 10 13 (liposomes/kg), respectively ( n = 5 mice/group). (F) A schematic illustration of toxicity profiling experimental design, as detailed in Materials and Methods. (G) The average weight of 8 week old BALB/c mice treated with ATBL (1.95 ± 0.43 × 10 13 liposomes/kg) or control administered once a week for 4-week period ( n = 5 mice/group) was assessed weekly. (H) The WBC count of mice treated as in G was measured at end point (after 4 weeks of treatment). Results are presented as mean ± SD. Two-tailed unpaired Student’s t test was used for the statistical analysis in B and C. Two-way ANOVA was used for the statistical analysis in E and G with multiple comparisons test. One-way ANOVA was used for the statistical analysis in H with multiple comparisons test, adjusted p-value; * p < 0.05, *** p < 0.001, **** p < 0.0001. ns, not significant; BM, bone marrow; MM, multiple myeloma; RPMI, RPMI8226; MTD, maximum tolerated dose; WBC, white blood cell; ATBL, AMD targeted bortezomib liposomes; BTZ-F, bortezomib free drug; AMD-L, AMD3100 liposomes; EMPTY-L, empty nontargeted liposome; Control, vehicle.

Article Snippet: A single guide RNA (gRNA) for CXCR4 (forward: 5′CACCG AGGGGACTATGACTCCATGA 3′; reverse: 5′AAAC TCATGGAGTCATAGTCCCCT C 3′) was cloned into the lentiCRISPR v2 vector plasmid (Addgene, Watertown, MA, USA Cat# 52961) containing puromycin resistance using the Golden Gate assembly reaction as described.

Techniques: Irradiation, Injection, Labeling, Liposomes, Flow Cytometry, Expressing, Control, Two Tailed Test